You are viewing the site in preview mode

Skip to main content

Advertisement

Table 1 Information of the oligonucleotides used for the qPCR analysis

From: Alterations in bacterial communities, SCFA and biomarkers in an elderly HIV-positive and HIV-negative population in western Mexico

Primer Sequence (5′-3′) Temp. (°C) Prod. size (bp) Reference
16S rRNA 16S-F AGTTTGATCCTGGCTCAG 62 500 González et al.; 2012
16S-R GWATTACCGCGGCKGCTG
Bacteroidetes Bact-F GGARCATGTGGTTTAATTCGATGAT 63 126 Guo et al.; 2008
Bact-R AGCTGACGACAACCATGCAG
Firmicutes Firm-F GGAGYATGTGGTTTAATTCGAAGCA 63 126 Guo et al.; 2008
Firm-R AGCTGACGACAACCATGCAC
Proteobacterias Prot-F TCGTCAGCTCGTGTYGTGA 56 170 Bacchetti De Gregoris et al.; 2011
Prot-R CGTAAGGGCCATGATG
Actinobacterias Acti-F TACGGCCGCAAGGCTA 57 170 Liang et al.; 2016
Acti-R TCRTCCCCACCTTCCTCCG
Lactobacillus (genero) Lacto-F GCGGTGAAATTCCAAACG 56 216 Hermann et al.; 2013
Lacto-R GGGACCTTAACTGGTGAT
Bifidobacterium Bifi-F CGGGTGAGTAATGCGTGACC 56 139 Furet et al.; 2009
Bifi-R TGATAGGACGCGACCCCA
C. leptum Clep-F CCTTCCGTGCCGSAGTTA 60 115 Furet et al.; 2009
Clep-R GAATTAAACCACATACTCCACTGCTT
C. coccoides Ccoc-F GACGCCGCGTGAAGGA 56 199 Furet et al.; 2009
Ccoc-R AGCCCCAGCCTTTCACATC