You are viewing the site in preview mode

Skip to main content

Advertisement

Table 1 Primer/probe used in qPCR and nest PCR

From: Adenovirus associated with acute diarrhea: a case-control study

  Primer/probe Sequence (5′-3′) Reference
qPCR F-primer GCCCCAGTGGTCTTACATGCACATC [15]
R-primer GCCACGGTGGGGTTTCTAAACTT
probe FAM-TGCACCAGACCCGGGCTCAGGTACTCCGA-TAMRA
nested PCR AdhexF1 TICTTTGAC ATICGIGGIGTICTIGA [16]
AdhexR1 CTGTCIACIGCCTGRTTC CACA
AdhexF2 GGYCCYAGYTTYAARCCCTAYTC  
AdhexR2 GGTTCTGTCICCCAGAGARTCIAGCA