You are viewing the site in preview mode

Skip to main content

Advertisement

Table 1 Primers used for PCR amplification and sequencing of bla CTX-M genes

From: Randomized controlled trial of piperacillin-tazobactam, cefepime and ertapenem for the treatment of urinary tract infection caused by extended-spectrum beta-lactamase-producing Escherichia coli

Target Name of primer Sequence (5′ ➔ 3′) Expected size of amplicon (bp) Reference
CTX-M-1 group CTX-M-1F CTX-M-1R GCAGCACCAGTAAAGTGATGGGCTGGGTGAAGTAAGTGACC 591 [28]
CTX-M-9 group CTX-M-9F CTX-M-9R GCTGGAGAAAAGCAGCGGAGGTAAGCTGACGCAACGTCTG 474 [29]