You are viewing the site in preview mode

Skip to main content

Advertisement

Table 1 Sequences of primers and probes, amplicon sizes, amplicon positions (in VP1 region) in target genome and reference strain used in the 13-plex Luminex assay [59]

From: Multiplex detection in tonsillar tissue of all known human polyomaviruses

Virus Forward/Reverse (5′ biotinylated) Primers sequence (5′-3′) Probe (5′ amine-C12) sequence (5′-3′) Amplicon length (bp) Amplicon position (bp) in target genome Reference strain (GenBank accession no.)
JCPyV AATGAGGATCTAACCTGTGGAA/CTGCACCATTGTCATGAGTTGCTTG ATGAATGTGCACTCTAATGG 127 1742–1868 J02226
BKPyV ACAGAGGTTATTGGAATAACTAG/ACTCCCTGCATTTCCAAGGG CTTAACCTTCATGCAGGGTC 143 1952–2094 DQ305492
KIPyV TTGGATGAAAATGGCATTGG/TAACCCTTCTTTGTCTAAAATGTAGCC CTTGGAACAGCTAATAGTAGAATC 142 2263–2404 EF127906
WUPyV TTGGATGAAAATGGCATTGG/TAACCCTTCTTTGTCTAAAATGTAGCC GAGTACATACAGGGCTTTCCAG 142 2411–2552 EF444554
MCPyV TTCCATCTTTATCTAATTTTGCTT/AGGCCTAGTTTTAGATTACCAGAC GTAATAGGCCCACCATTTGT 144 3757–3900 EU375803
HPyV6 TTGCTTCTGGATCCAATACTGC/GGCCTCAGGAATTTCAGGCAA TGGATGCTGGTTCATCTCTG 131 1426–1556 HM011558
HPyV7 AAGCAGCTACAACTGGGAACTT/GGCCTCAGGAATTTCAGGCAA GCCTACCTTATCCTATGAGTG 125 1450–1574 HM011566
TSPyV AGAATGTATGATGACAAAGGTAT/TCTGTAGTTTCCAGTTAGAAAC TGAGGGAATGAATTTCCATATGTT 111 1722–1832 GU989205
HPyV9 ATCTATGGCTCATCCTCAGG/GTAGAGCTAGCAACTAGGCCT AGTGCAGGGTACCACTCTC 107 1862–1968 KC831440
HPyV10 GTCCAGTTCCTACTAAAGTTCCT/TACATCATTGCCCATCCTTGGTT GCCGGACACCACAATGACA 106 1501–1628 JQ898292
STPyV TGAATATGATCCGTGCCAAA/ACTGCATCAGGGCCTACTTG CCTCCTCCAACATGTGTTCC 129 1318–1446 JX463184
HPyV12 GTAATGGCACCCAAGAGGAA/GGGGATTTAGAAAGGCCTCA CCCAGCAGTGTCCCTAAATT 157 1402–1558 JX308829
NJPyV TGTGTGCCAAAGAAGTGTCCT/TCTGTCACCTGTTGGAGCATT CTGATGCTACTACTGAAATTGAA 159 1113–1271 KF954417
  1. Sequences for primers and probes for all except MCPyV, STPyV, HPyV12 and NJPyV as in Gustafsson et al [53].