You are viewing the site in preview mode

Skip to main content

Advertisement

Table 1 Primers used for SYBR Green mediated, multiplex real-time PCR assay [10]

From: Real time PCR for the rapid identification and drug susceptibility of Mycobacteria present in Bronchial washings

Organism Target region Primer sequence (5’–3’) Reaction
Mycobacterium avium 16S F:CCTCAAGACGCATGTCTTC I
R: ACCTACCGTCAATCCGAGAA
Mycobacterium intracelulare 16S F:GACCTTTAGRCGCATGTCTTT I
R: ACCTACCGTCAATCCGAGAA
Mycobacterium tuberculosis Complex ITS F: GCGAGAGCCGGGTGCATG I
R: AACAGTGTGTTGGTGGCCAA
AFB genus 16S F: CCGCAAGRCTAAAACTCAAA I/II
R: TGCACACAGGCCACAAGGGA
MCAG ITS F: TAAGGAGCACCATTTCCCAG II
R: CGACGTTTTGCCGACTACC
MFG 16S F: CCACGCGCTTCATGGTGT II
F: CCGCGCTCTTCATGGGGT
F: ACCACGCATTTCATGGTGT
R:ACTTGCGCTTCGTCCCTAT