You are viewing the site in preview mode

Skip to main content

Advertisement

Table 2 miRBase IDs and mature miRNA sequences for miRNAs included in the qPCR verification

From: Nasal mucosal microRNA expression in children with respiratory syncytial virus infection

miRBase ID Accession1 Assay2 Mature miRNA Sequence
hsa-let-7d-5p MI0000065 002283 AGAGGUAGUAGGUUGCAUAGUU
hsa-let-7f-5p MIMAT0000067 000382 UGAGGUAGUAGAUUGUAUAGUU
hsa-let-7g-5p MIMAT0000414 002282 UGAGGUAGUAGUUUGUACAGUU
hsa-let-7i-5p MIMAT0000415 002221 UGAGGUAGUAGUUUGUGCUGUU
hsa-miR-16-5p MIMAT0000069 000391 UAGCAGCACGUAAAUAUUGGCG
hsa-miR-19a-3p MIMAT0000073 000395 UGUGCAAAUCUAUGCAAAACUGA
hsa-miR-21-5p MIMAT0000076 000397 UAGCUUAUCAGACUGAUGUUGA
hsa-miR-23b-3p MIMAT0000418 000400 AUCACAUUGCCAGGGAUUACC
hsa-miR-26b-5p MIMAT0000083 000407 UUCAAGUAAUUCAGGAUAGGU
hsa-miR-27b-3p MIMAT0000419 000409 UUCACAGUGGCUAAGUUCUGC
hsa-miR-29c-3p MIMAT0000681 000587 UAGCACCAUUUGAAAUCGGUUA
hsa-miR-30b-5p MIMAT0000420 000602 UGUAAACAUCCUACACUCAGCU
hsa-miR-30d-5p MIMAT0000245 000420 UGUAAACAUCCCCGACUGGAAG
hsa-miR-31-5p MIMAT0000089 002279 AGGCAAGAUGCUGGCAUAGCU
hsa-miR-34b-5p MIMAT0000685 000427 UAGGCAGUGUCAUUAGCUGAUUG
hsa-miR-34c-5p MIMAT0000686 000428 AGGCAGUGUAGUUAGCUGAUUGC
hsa-miR-96-5p MIMAT0000095 000186 UUUGGCACUAGCACAUUUUUGCU
hsa-miR-125a-5p MIMAT0000443 002198 UCCCUGAGACCCUUUAACCUGUGA
hsa-miR-125b-5p MIMAT0000423 000449 UCCCUGAGACCCUAACUUGUGA
hsa-miR-130a-3p MIMAT0000425 000454 CAGUGCAAUGUUAAAAGGGCAU
hsa-miR-146a-5p MIMAT0000449 000468 UGAGAACUGAAUUCCAUGGGUU
hsa-miR-148a-3p MIMAT0000243 000470 UCAGUGCACUACAGAACUUUGU
hsa-miR-155-5p MIMAT0000646 002623 UUAAUGCUAAUCGUGAUAGGGGU
hsa-miR-183-5p MIMAT0000261 002269 UAUGGCACUGGUAGAAUUCACU
hsa-miR-200b-5p MIMAT0004571 002274 CAUCUUACUGGGCAGCAUUGGA
hsa-miR-203a MI0000283 000507 GUGAAAUGUUUAGGACCACUAG
hsa-miR-205-5p MIMAT0000266 000509 UCCUUCAUUCCACCGGAGUCUG
hsa-miR-223-3p MIMAT0000280 002295 UGUCAGUUUGUCAAAUACCCCA
hsa-miR-324-3p MIMAT0000762 002161 ACUGCCCCAGGUGCUGCUGG
hsa-miR-331-3p MIMAT0000760 000545 GCCCCUGGGCCUAUCCUAGAA
hsa-miR-375 MI0000783 000564 UUUGUUCGUUCGGCUCGCGUGA
hsa-miR-429 MI0001641 001024 UAAUACUGUCUGGUAAAACCGU
  1. 1miRBase accession number [41].
  2. 2Life Technologies’ assay ID.