You are viewing the site in preview mode

Skip to main content

Advertisement

Table 1 Sequences of primers to detect the gene for 16S rRNA, NADH oxydase (nox) of Brachyspira aalborgi and Brachyspira pilosicoli

From: Clinicopathologic study of intestinal spirochetosis in Japan with special reference to human immunodeficiency virus infection status and species types: analysis of 5265 consecutive colorectal biopsies

Primer Sequence Size of products (bp)
B. aalborgi 16S rRNA F: TACCGCATATACTCTTGAC 472
  R: CCTACAATATCCAAGAACC  
B. aalborgi nox F: GGTTGACTCAAGCACTAC 334
  R: AAACCGTATTTTGTTCCAGG  
B. pilosicoli 16S rRNA F: AGAGGAAAGTTTTTTCGCTTC 196
  R: GTCGCTCCATCAGACTTT  
B. pilosicoli nox F: GTAACTCCTCCTATTGAG 465
  R: GCACCATTAGGTAAAGTC  
D8S348 F: ACCGACAGACTCTTGCCTCCAAA 408
  R: TCACTCAGCTCCCATAACTTGGCAT  
  1. F, forward; R, reverse.