You are viewing the site in preview mode

Skip to main content

Advertisement

Table 1 Primers, probes and restriction enzymes

From: Common TNF-α, IL-1β, PAI-1, uPA, CD14 and TLR4 polymorphisms are not associated with disease severity or outcome from Gram negative sepsis

Gene SNP Sense primer Antisense primer Probe/restriction enzyme
TNF-α G- 308 A 5'-TAGGTTTTGAGGGGCATGGGGAC-3' 5'- TCTCGGTTTCTTCTCCATCG -3' 5'-TAGGTTTTGAGGGGCATGGGGAC-3'-fluorescein 5'-LC Red640-GGGTTCAGCCTCCAGGGTCCTACACAC-3'-phosphate
Il-1β C3953T 5'-CACTCCCAGCTTCATCCCTA-3' 5'-AGGTGCATCGTGCACATAAG-3' Taq I
PAI-1 4G/5G 5G allele; 5 ' -GTCTGGACACGTGGGGG-3 ' 4G allele; 5 ' -GTCTGGACACGTGGGGA-3 ' 5 ' -TGCAGCCAGCCACGTGATTGTCTAG-3 ' None
uPA C 422 T 5'-biotin-ACTGCAGGAACCCAGACAAC-3' 5'-AGGGAGGCAGGTAGGAGAAA-3' 5'-GCCTAAAGCCGCTTGTCCAA-3' 5'-GGCCTAAAGCTGCTTGTCCAA-3'
TLR4 A 896G 5'-biotin-AGTCCATCGTTTGGTTCTGG-3' 5'-AATAGTCACACTCACCAGGGAAA-3' 5'-AGTCAATAATATCATCGAGGTAG-3' 5'-AGTCAATAATACCATCGAGGTAG-3'
CD14 C-159T 5'-biotin-CACCCACCAGAGAAGGCTTA-3' 5'-ATCACCTCCCCACCTCTCTT-3' 5'-GGAGGGGGGCCGTAACA-3' 5'-GGGAGGGGGACCGTAACAG-3'
  1. TNF-α: tumor necrosis factor alpha; Il-1β: interleukin-1 beta; PAI-1: plasminogen activator inhibitor 1; uPA: urokinase-type plasminogen activator; TLR4: toll-like receptor 4; CD14: cluster of differentiation 14; A: adenine; T: thymidine; C: cytosine; G: guanine; SNP: single nucleotide polymorphism; LC: light cycler