You are viewing the site in preview mode

Skip to main content

Advertisement

Table 1 Primers and probes used for qPCR

From: Persistence, clearance and reinfection regarding six high risk human papillomavirus types in Colombian women: a follow-up study

Region Viral type Primer sequence 5′ - 3′ mT* Plasmid product quantification qPCR test Probe Probe size (bp) Quencher
E7 HPV-16 AGCTCAGAGGAGGAGGAT 54 1.43E1012 Reaction 1 FAM 78 ZEN/Iowa Black FQ
   GGTTACAATATTGTAATGGGCTC       
E1 HPV-18 CATTTTGTGAACAGGCAGAGC 53.7 1.19E1012 Reaction 2 Cy5 80 IBRQ
   ACTTGTGCATCATTGTGGACC       
E6 HPV-31 ACGATTCCACAACATAGGAGGA 53.7 1.35E1012   HEX 78 ZEN/lowa Black FQ
   TACACTTGGGTTTCAGTACGAGGT       
E7 HPV-33 ATTAAGTGACAGCTCAGATGA 53.7 1.86E1012 Reaction 3 FAM 78 ZEN/Iowa Black FQ
   ACATAAACGAACTGTGGTGTT       
E1 HPV-45 CCATTTGTGAACAGGCAGAGC 53.7 1.59E1012   Cy5 76 IBRQ
   CAACACCTGTGCATCATTCTGA       
E7 HPV-58 CGAGGATGAAATAGGCTTGG 53.7 1.23E1012 Reaction 4 HEX 109 ZEN/Iowa Black FQ
   ACACAAACGAACCGTGGCGT       
HMBS GCCTGCAGTTTGAAATCAGTG 53.7 1.98E1012   FAM 76 ZEN/Iowa Black FQ
   CGGGACGGGCTTTAGCTA       
  1. HPV Human papillomavirus, mT Melting temperature in °C, FAM 6-carboxyfluorescein, Cy5 FluoroLink Mono Reactive Dye Cy5, HEX Hexachlorofluoresceine, HMBS, Hydroxymethylbilane synthase.
  2. *Melting temperature for quantitative real-time PCR.