Skip to content

Advertisement

  • Research article
  • Open Access
  • Open Peer Review

This article has Open Peer Review reports available.

How does Open Peer Review work?

Identification and real-time expression analysis of selected Toxoplasma gondii in-vivoinduced antigens recognized by IgG and IgM in sera of acute toxoplasmosis patients

  • 1,
  • 1,
  • 1,
  • 2,
  • 1,
  • 1,
  • 1 and
  • 1Email author
BMC Infectious Diseases201313:287

https://doi.org/10.1186/1471-2334-13-287

Received: 20 March 2013

Accepted: 13 June 2013

Published: 24 June 2013

Abstract

Background

Toxoplasma gondii is an obligate intracellular zoonotic parasite of the phylum Apicomplexa which infects a wide range of warm-blooded animals, including humans. In this study in-vivo induced antigens of this parasite was investigated using in-vivo induced antigen technology (IVIAT) and pooled sera from patients with serological evidence of acute infection.

Methods

The pooled sera was first pre-absorbed against three different preparations of antigens from in-vitro-grown cells of each T. gondii and E. coli XL1-Blue MRF’, subsequently it was used to screen T. gondii cDNA phage expression library. Positive clones from each group were subjected to quantitative real-time PCR expression analysis on mRNA of in-vivo and in-vitro grown parasites.

Results

A total of 29 reactive clones from each IgM and IgG immunoscreenings were found to have high homology to T. gondii genes. Quantitative real-time PCR expression analysis showed that 20 IgM-detected genes and 11 IgG-detected genes were up-regulated in-vivo relative to their expression levels in-vitro. These included genes encoding micronemes, sterol-regulatory element binding protein site, SRS34A, MIC2-associated protein M2AP, nucleoredoxin, protein phosphatase 2C and several hypothetical proteins. A hypothetical protein (GenBank accession no. 7899266) detected by IgG had the highest in-vivo over in-vitro fold change of 499.86; while another up-regulated hypothetical protein (GenBank accession no. 7898829) recognized by IgM showed high sensitivity (90%) and moderate specificity (70%) in detecting T. gondii antibodies when tested with 20 individual serum samples.

Conclusion

The highly up-regulated genes and the corresponding proteins, in particular the hypothetical proteins, may be useful in further studies on understanding the disease pathogenesis and as potential vaccine candidates.

Keywords

  • Toxoplasma gondii
  • In-vivo induced antigen technology (IVIAT)
  • cDNA library immunoscreening
  • Acute toxoplasmosis sera
  • mRNA expression analysis
  • Real-time polymerase chain reaction (PCR)

Background

Toxoplasmosis is caused by the zoonotic and ubiquitous Toxoplasma gondii, with up to 30% of the world human population affected by this parasite. Infection usually occurs by ingestion of T. gondii oocysts from infected cats or consumption of undercooked meat containing the parasite cysts. Environmental, cultural factors and eating habits are thought to be contributing factors in the transmission of this infection [14]. The foetus of an infected mother can acquire this infection by vertical transmission through the placenta during early pregnancy. In congenital toxoplasmosis most of the mothers and newborns are asymptomatic but severe sequelae may develop later in the infant life such as inflammatory lesions, mental retardation, seizures and choriorentitis with or without hydrocephaly. Prompt treatment of the affected child would be possible if diagnosed early [58]. Diagnosis of toxoplasmosis is usually performed by detection of IgG and IgM against T. gondii. In addition, IgG avidity test is an important additional test that is routinely performed; with low IgG avidity suggesting acute infection while high IgG avidity confirms chronic infection [9].

In-vivo induced antigen technology (IVIAT) is a new and promising method introduced by Martin Handfield et al. in 2000 which can be used to determine in-vivo induced antigens that are directly related to the human infection and thus reduce false-positive results caused by the differences between proteins expressed during in-vitro culture and actual human infection [10]. IVIAT uses sera from patients or animals infected with the pathogen of interest and therefore obviate the need for animal models. Up-regulation of identified genes by IVIAT can be assessed by techniques such as quantitative real time PCR (RT-PCR) or microarray [1012]. In a previous study, our group has used IVIAT to identify in-vivo induced genes of T. gondii which expresses proteins reactive with Toxoplasma specific IgG antibodies in chronically-infected individuals [13].

In the present study we applied IVIAT to identify in-vivo induced antigens of T. gondii using sera of acutely-infected patients with low anti-Toxoplasma IgG avidity and high IgM positivity. These antigens may be potentially useful as diagnostic markers, vaccine candidates or in increasing our understanding of the disease pathogenesis.

Methods

Parasite strain and growth conditions

In-vitro culture of T. gondii RH strain in Vero cells was performed under conditions previously optimized in our laboratory [14]. Vero cells were washed four times at 85% confluence with phosphate buffered saline (PBS), followed by addition of DMEM medium (Gibco BRL, USA) containing 100 μg/ml streptomycin and 100 IU/ml penicillin (Gibco BRL, USA) with 10% (v/v) fetal bovine serum (Invitrogen, USA). Subsequently the cells were seeded with 1x107 T. gondii tachyzoites harvested from infected mice. After 3–4 days the maximum release of tachyzoites was observed and the culture containing parasites was centrifuged and the pelleted tachyzoites was kept at −80°C.

To produce in-vivo grown tachyzoites, Swiss albino mice were intraperitoneally infected with 1 × 103 tachyzoites of T. gondii RH strain. After three to four days post-infection, the peritoneal cavity fluid was aseptically harvested with 5 ml of RPMI-1640 medium containing penicillin streptomycin (RPMI-PS), pH 7.2 (Gibco®, Life Technologies, USA). The supernatant containing tachyzoites was collected, centrifuged, washed with PBS and pelleted tachyzoites immediately kept at −80°C for RNA extraction. Approval from the USM Animal Research Ethics Committee was obtained prior to performing the animal infection.

Serum samples

Commercial IgM and IgG ELISA kits (Euroimmun, Germany) were used to determine the Toxoplasma serology status of the serum samples in this study. Twelve sera samples were obtained from patients with clinical evidence of toxoplasmosis. Toxoplasma serology performed on the serum samples showed high IgM antibody levels and low IgG avidity indices. These sera were collected by one of the co-authors from Molecular Parasitology Laboratory, Parasitology Department, Pasteur Institute of Iran. Ethical clearance from the institution and informed consents from patients were obtained. Prior to performing IVIAT, equal volume of each serum samples was pooled. Out of a total of 12 serum samples, 10 were individually used to determine sensitivity of selected clones. In addition, another 10 serum samples from healthy individuals which were negative for both anti-Toxoplasma IgM and IgG antibody were individually used to determine specificity of selected clones.

Sera pre-adsorption

Sera adsorption was performed according to previously reported protocol with some slight modifications in order to increase efficiency of the process so as to ‘completely’ remove in-vitro antigens [13, 15]. One modification was to increase the incubation of pooled sera with each of cell pellet, heat denatured and non-heat-denatured cell lysates of T. gondii & E. coli XL1-Blue MRF’ from 1 h to overnight at 4°C on a shaker. Each step was repeated twice and thimerosol (1%) was added in order to prevent contamination. Serum samples used for sensitivity and specificity determination (section 2.8) were preadsorbed with pellet, heat denatured and non-heat-denatured cell lysates of only E. coli XL1-Blue MRF’. The efficiency of sera adsorption at each step was checked using indirect enzyme-linked immunosorbent assay (ELISA) according to the previously optimized protocol [13]. The final adsorbed sera sample was centrifuged and kept at −80°C.

T. gondii expression library

Custom-made T. gondii cDNA expression library was constructed in Lambda ZAP® II system (Strategene, USA) using mRNA from in-vitro grown T. gondii pellet. The previously optimized dilution of cDNA library immunoscreening was 103 for primary screening which produces around 500–1000 plaques per plate. For secondary and tertiary screening 104 and 105 dilutions of cDNA library were used respectively.

cDNA library immunoscreening

For T. gondii cDNA library screening a modified version of a previously reported method was used [16]. For primary screening, the 103 dilution of cDNA library was mixed with 600 μl of E. coli XL1-Blue MRF’ cells at OD600nm 0.5, then plated on LB agar plates 3–4 h in a 42°C incubator until the plaques became visible. On the next day, the agar plates were overlaid with nitrocellulose filter disc pre-saturated with 10 mM isopropyl-β-D-thiogalactopyranoside (IPTG) and incubated overnight at 28°C. The filters were then removed from the plates, washed (colony side up) with PBS-Tween 20, blocked with 1:5 dilution of Super Block solution (Thermo Scientific, USA) and incubated overnight with adsorbed pooled serum at dilution 1:100. Subsequently after three step of washing with PBS-Tween 20 the filters were incubated with peroxidase-anti-human IgG (Invitrogen, USA) at 1:3000 dilution or peroxidase-anti-human IgM (Invitrogen, USA) at 1:2000 dilution for 1 h, washed and then developed using chemiluminescence substrate (Roche Diagnostics, Germany). The phage plaques on the agar plates which corresponded to positive plaque images on the X-ray film were cored out and subjected to secondary and tertiary screenings using the same serum. For secondary and tertiary screenings, higher dilutions were used to produce much lower density plaques (<50 per plate) with many isolated clones. Final positive clones were isolated and placed in 500 μl SM buffer containing 3% chloroform overnight at 4°C. Part of them were used directly for in-vivo excision, while the rest were centrifuged and the supernatant placed in 500 μl SM buffer with 7% DMSO for long-term storage at −80°C.

In-vivoexcision and plasmid purification

In-vivo excision was performed to convert the recombinant phages to recombinant plasmids. The selected phage clone (in 250 μl SM buffer) and 1 μl ExAssist helper phage (>106 pfu/ml) (Stratagene, USA) was added to 200 μl of E. coli XL1-Blue MRF’ cells at OD450nm 1.0. The culture was incubated at 37°C for 15 min followed by addition of 3 ml of LB broth and incubation in 65°C for 20 min. After centrifugation 10 μl of supernatant (excised phagemids) was mixed with 200 μl of SOLR cells (Stratagene, USA) at OD 1.0 (405 nm) and plated overnight at 37°C on LB ampicillin agar plate. Plasmids from each sample was purified using commercial plasmid preparation kit (Promega, USA) and sent for sequencing using M13 forward and reverse primers. The sequences identified by IVIAT in current study after sequencing were then analyzed using GenBank and ToxoDB (http://toxodb.org/toxo) databases. ToxoDB, a functional genomic database for T. gondii which incorporates sequence and annotation data, is integrated with other genomic-scale data, including community annotation; expressed sequence tags (ESTs) and gene expression data [17].

Quantitative real-time PCR analysis

The forward and reverse primers for each of the sequences were designed using Primer Express 2.0 software (Applied Biosystems, USA). Table 1 shows the primers designed based on sequences of IgM-detected genes; while Table 2 shows the primers designed based on sequences of IgG-detected genes. Pooled in-vitro-grown tachyzoites from 20 culture flasks (75 cm2) (Nunclon, Roskilde, Denmark) and pooled in-vivo-grown tachyzoites from 35 mice were prepared as described above. Total RNA was extracted and purified using RNAeasy mini kit (Qiagen, Germany). The DNase-treated RNA samples were converted to cDNA using High Capacity cDNA Reverse Transcription Kits (Applied Biosystems, USA). Real-time PCR was performed using Quanti FastTect SYBR Green PCR Kit (Qiagen, Germany) in a Rotor Gene 6000 Multiplex System (Corbett Research, Australia). Each of the reaction mix comprised 5 μl of cDNA (200 to 400 ng), 200 pmol of each primer (forward and reverse) and 12.5 μl of 2× SYBR Green mix and sufficient amount of dH2O to bring the volume to 25 μl. The parameters for thermocycler were as follow: 95°C for 5 min short hot-start, followed by 40 cycles of 95°C for 10 sec for denaturing and subsequently combine annealing/extension at 60°C for 30 sec. At the final step of real-time PCR, melting curves with 1°C temperature increments from 72°C to 95°C were incorporated. Data analysis was performed using Rotor Gene 6000 Series Software 1.7. First the expression level was normalized to the reference β-actin gene as housekeeping gene. Next the fold change of in-vivo expression of the gene relative to its in-vitro expression level was calculated using 2-ΔΔCt method [18].
Table 1

Primers used in real-time PCR analysis of T.gondii IVIAT identified genes by IgM

GenBank ID/accession no.

Primer

 

Orientation sequence

** β -Actin

*F

5′-TCACACTGTGCCCATCTACGA-3′

*R

5′-GTGGTGAAGCCGTATCCTCTCT-3′

7895406

F

5′-ACCGACTCGAAGCACAACAGT-3′

R

5′-CATCGTAGGTGACGAACAATGC-3′

7898829

F

5′- CAATGTTTCGGGCAGCTCAT -3′

R

5′- GCTGTACTGAAACCGTCGATGTAG -3′

7894091

F

5′- CCACTCAAGCAGTTCCTGAAGA -3′

R

5′- GATCTCCGCGAAATCTGTCTCT -3′

7900912

F

5′- CGCATTTACAAGCGCCTGAT -3′

R

5′- TTCCACGCCTCGTTTACATG -3′

7899945

F

5′- CTTCTCGACGACATGCATCTG -3′

R

5′- TGGACGCACTGGATGTTCTG -3′

7893976

F

5′- AGCGCAGCAAGAACCAAGA -3′

R

5′- TTCCTCAAGAAGGCCATGGA -3′

7893824

F

5′- CTCACGTACGAGGCTAGATCCA -3′

R

5′- GTCCGCCAGGGCATTCTATT -3′

7899621

F

5′- AGGCACAGGCTCCACCATAC -3′

R

5′- AGCTCCAGGACGCGTAAGAG -3′

7901413

F

5′- TCTGAAGCTGCAAGGTTCCA -3′

R

5′- TTGCAGAGTAGGCTCGTCAAAC -3′

7894150

F

5′- TCCTCGAACGGCAGAGAAA -3′

R

5′- CCCCTCAGGTGTGAAGACATCT -3′

7895338

F

5′- AGAGCCGGTAGCACTGTGTTC -3′

R

5′- CGGTAACCCGGTGGACTTCT -3′

7898197

F

5′- GGATTTCGGCACGCTCAAT -3′

R

5′- CAACTGTGGCTCCCGACTACTT -3′

7895974

F

5′-CCAAATCGGTTCGCTCATGT-3′

R

5′-GCAAAGGCCGGAGAATTCAT-3′

7900011

F

5′-CACGCTAACTGTTTCAGGTACGA-3′

R

5′-TACAGCAGCGTGTTCATTTGC-3′

7895000

F

5′-TCCAACATCCCGACCTGATC-3′

R

5′-GCTTCGACCTTCGCATTCTTC-3′

L06091.1

F

5′-CAGACTCCTTGCTCTCTTCTTGAA-3′

R

5′-GTTGTGTCACTACTGCGATTGTTG-3′

7896316

F

5′-AAGGTGCTTCATCCGCCATA-3′

R

5′-GGTCTTGCATATCTCGCCATTC-3′

7894239

F

5′-GAACTGTTTCAATGCGTCGATT-3′

R

5′-GTGATCCAATCGCACACTCTTTT-3′

7896580

F

5′-CCTTCTGGTTAGCCACATCTGAT-3′

R

5′-GGCGACGAAGATGATTTTGAC-3′

7899034

F

5′-CCTGGAACGTCCTTTCTGGAT -3′

R

5′-ATCTAACCGTCGCGCTGGTA -3′

7899034

F

5′-ATGTTCCCGATCCAGAGCAA-3′

R

5′-GGTGTGGCTGTCTCCCTATTTT-3′

AY707938.1

F

5′-GAACGCGAACAATGAGTTTG-3′

R

5′-CCGCTGGTCGAAATAATGATG-3′

7894324

F

5′-GTTAATCAGGAGCAGACCCGATA-3′

R

5′-TAAGCTACCCCTGAGCAAGTTGT-3′

AF364813.1

F

5′-GGTGGAAAGTGAATACCGTGGAT-3′

R

5′-CAGTGAGTCCGAATGCCAAAT-3′

7900910

F

5′-GCCTGCAACATGTCCAACTTC-3′

R

5′-TCAGCGGCTAAGCGAAAAAG-3′

7896316

F

5′-CATACGGATAGGCGGTCATGTA-3′

R

5′-GTATACGAACGCCCTGATGTTG-3′

7897539

F

5′-ATGCAAGACCCAAGGCAAAC-3′

R

5′-TGTACGGAACGCTTCTTCGA-3′

7895127

F

5′-GCGAAAGTCAAACGGAATGG-3′

R

5′-TTCTGCGCGGAGTCGTTATT-3′

7896796

F

5′-GCTTTTACCTGCTCGGGAAGT-3′

 

R

5′-AACGCATCTCACACGGATAGC-3′

*F forward, R reverse.

**β-Actin was used as the housekeeping gene.

Table 2

Primers used in real-time PCR analysis of T.gondii IVIAT identified genes by IgG

GenBank ID/accession no.

Primer

 

Orientation sequence

** β -Actin

*F

5′-TCACACTGTGCCCATCTACGA-3′

*R

5′-GTGGTGAAGCCGTATCCTCTCT-3′

7901108

F

5′-AAAGATGCTCCACGCCAACT-3′

R

5′-GTTTGTCCACGTTGCTTCCA-3′

7901478

F

5′-TGAGCCAGAAACCTGACAAACA-3′

R

5′-ATCGCCTTTTCCGCTGATTT-3′

7894322

F

5′-TCCTAAAGCTCGGCGGAATT-3′

R

5′-CGGTTTGGGCTTTCCAGTTT-3′

7894761

F

5′-AGGCGTTTCAACCGACTCTGT-3′

R

5′-ACCTGTGGCACAACAAGACATC-3′

7897485

F

5′-CAAGCGTGAGTTCGAGCAATAC-3′

R

5′-GGCTTCCCATTTCGGTCATA-3′

7899395

F

5′-TCGTGGTGGACAAGGTATAGGAT-3′

R

5′- CCATAGTTGTCGGAAGAGTCGTT-3′

7895435

F

5′- GGGAAAGCATCTGGCTTCAA-3′

R

5′- GAGGAACGGAAAGTAGCGGAAT-3′

7895096

F

5′-CTCGAAACGATCGCTGCTTT-3′

R

5′-ACTCCCGCAGAGTTCAAGACTT-3′

7895077

F

5′-CCTTCCACAAGTTGGCACAGA-3′

R

5′-CAGTAGCTCCTCAAGCAGTGACA-3′

7897605

F

5′-GATGATCGAAGCTCGCAAGTG-3′

R

5′-TAGACAAGGTGCCGCATCAAC-3′

7899217

F

5′-GTTCCTCGAGCTTTCCAACCT-3′

R

5′-AGAGCTGCATCTGGAGCAGAA-3′

AM055942.3

F

5′-GAGGCACCGCTTCTTCTATACTG-3′

R

5′-TGGGATCGTGTAAGCCATAGC-3′

7894058

F

5′-TTTCCCTGCGGAGCAGTCT-3′

R

5′-CGCCTGCAACCTGAGATGA-3′

7893896

F

5′-GCGAAAGGTCTGGAACATTTG-3′

R

5′-GGCAGGTAGGAAAGGAAATCGT-3′

7899266

F

5′-GGCACTTGTCAATGCAGAACA-3′

R

5′-CTAATTGACCGGTGCACGAAA-3′

7893521

F

5′-GGAGGTCATCCTGTGGACTCA-3′

R

5′-GGCTCACGACTTTCACCTTCA-3′

7893531

F

5′-CGATACATGCGGCAGAGTCA-3′

R

5′-TGCTGGCTCGTCACATTCAG-3′

7896164

F

5′-ATCTCGGGAGTCTTCAGCAGACT-3′

R

5′-GACGGCTGTTTCTCGACTTTTC-3′

7896097

F

5′-TGTTGCTACCATGGGCCATT-3′

R

5′-TGTATCTGTGCCGGTCTTCGT-3′

7901507

F

5′-CGTATTCAAGCGCTGTTCGA -3′

R

5′-GAGACGATTGGCAGCGAATT -3′

7894761

F

5′-AACCGACTCTGTCGCATCTGT-3′

R

5′-CAAACCTGTGGCACAACAAGA-3′

7900407

F

5′-GCCTTCCTCGTAACCCAACTT-3′

R

5′-AAGCTTGCCAGAACGACGAA-3′

7897848

F

5′-CTGATTCGGGCACTGATTGA-3′

R

5′-GACGCGAAAAAGAGGGCATA-3′

7900113

F

5′-CGAGTTCTTTCGCGCTTTCT-3′

R

5′-ATGGTTGGCAGACGGTCAAG-3′

7899268

F

5′-TCAGCTCGGAAGCACAGAATC-3′

R

5′-ACGTGTCAGGCGGTGAATACT-3′

7893794

F

5′-TCCCGAAGGGAAAAAGTAGTCATA-3′

R

5′-TTTGTCTTGGACTTCCGTATACCA-3′

7893464

F

5′-CGAACCCTGCCAATTCTCAT-3′

R

5′-TCCATCCCCTCAGCAAAGTT-3′

7899477

F

5′-CTGTGTAAGGCGAATTTCTTTCG-3′

R

5′-AGAAGAGAATCTGGCACGATGTG-3′

AY424892.1

F

5′-CAGGAAGCCATGCACACTGT-3′

 

R

5′-GGCGACTCGATCCATTCCTA-3′

* F forward, R reverse.

** β-Actin was used as the housekeeping gene.

Sensitivity and specificity determination

To determine the sensitivity and specificity of selected clones, one clone was plated per petri dish and immunoscreening was performed as above with the exception that individual serum samples from acutely infected patients were used instead of pooled sera. Each nitrocellulose membrane was divided into six sections i.e. for six different serum samples. Positive and negative controls were included in each experiment. Sensitivity refers to the number of serum samples from acute-infected individuals (n = 10) which were reactive with the protein expressed by a particular clone. Thus if 8 serum samples are reactive out of 10, the sensitivity of the clone in the detection of anti-Toxoplasma antibodies in that group of serum samples is 8/10 or 80%. Specificity refers to the number of serum samples from healthy individuals (n = 10) which were not reactive with the protein expressed by a particular clone. Thus if 9 serum samples are not reactive out of the 10, the specificity of the clone in the detection of anti-Toxoplasma antibodies is 9/10 or 90%.

Results

Adsorption of pooled sera from patients with acute toxoplasmosis

Figures 1A and 1B show that the pooled sera were exhaustively pre-adsorbed against T. gondii and E. coli XL1-Blue MRF’ in-vitro antigens. Most of the reductions in OD values were observed after pre-adsorption with the pellet of the organisms. After the last step of serum pre-adsorption, the OD values of 0.001-0.009 were observed for serum diluted 1:100, which was the dilution used in the immunoscreening step.
Figure 1
Figure 1

Optical densities (OD) of pooled serum adsorped by E. coli and T. gondii . (A) serum adsorped by three different forms of E. coli XL1-Blue MRF’, and (B) serum adsorped by three different forms of T. gondii. 1-pooled non-preabsorped serum (control); 2-serum adsorped by whole cell; 3-serum adsorped by non-heat denatured cell lysate; and 4-serum adsorped by heat denatured cell lysate.

cDNA library tittering, screening and clone isolation

Approximately 10 000 and 14 000 clones from T.gondii recombinant phage cDNA library were screened with HRP-conjugated anti-human IgM and IgG respectively. A total of 35 clones were randomly selected from about 200 positive clones after the three stage immunoscreenings (primary, secondary and tertiary) with anti-human IgM-HRP. After sequencing, 29 clones showed high homology (80-100 %) to T. gondii genes (Table 3). Meanwhile a total of 38 clones were randomly selected from about 300 positive clones after the three stage immunoscreenings with anti-human IgG-HRP. After sequencing, 29 clones showed high homology (80-100%) to T. gondii genes (Table 4).
Table 3

Toxoplasma gondii IVIAT- identified genes by immunoscreening of cDNA library using anti-human IgM-HRP

GenBank ID/accession no.

Gene ID in Toxo DB

Gene name

Description

Homology percentage

1

7895406

TGME49_026460

hypothetical protein

Toxoplasma gondiiME49 hypothetical protein

99%

2

7898829

TGME49_057020

hypothetical protein

Toxoplasma gondiiME49 hypothetical protein

86%

3

7894091

TGME49_030160

hypothetical protein

Toxoplasma gondiiME49 hypothetical protein

97%

4

7900912

TGME49_066920

phosphodiesterase

Toxoplasma gondii ME49 phosphodiesterase, putative, mRNA

97%

5

7899945

TGME49_023050

40s ribosomal protein S20

Toxoplasma gondii ME49 40s ribosomal protein S20, putative

99%

6

7893976

TGME49_046620

G10 protein

Toxoplasma gondiiME49 G10 protein, putative

99%

7

7893824

TGME49_066140

sterol-regulatory element binding protein site

Toxoplasma gondii ME49 sterol-regulatory element binding protein site 2 protease, putative, mRNA

83%

8

7899621

TGME49_060190

microneme protein

Toxoplasma gondiiME49

95%

Toxoplasma gondii strain RH microneme protein 13 (MIC13) gene, complete cds

9

7901413

TGME49_004530

microneme protein

Toxoplasma gondii ME49 microneme protein TgMIC11 precursor (MIC11) mRNA, complete cds

80%

10

7894150

TGME49_001880

hypothetical protein

Toxoplasma gondiiME49 hypothetical protein

81%

11

7895338

TGME49_071740

hypothetical protein

Toxoplasma gondiiME49 hypothetical protein

80%

12

7898197

TGME49_086550

hypothetical protein

Toxoplasma gondiiME49 hypothetical protein

81%

13

7895974

TGME49_048600

aspartate aminotransferase

Toxoplasma gondii ME49 aspartate aminotransferase, putative, mRNA

91%

14

7900011

TGME49_093510

poly(ADP)-ribose polymerase domain-containing

Toxoplasma gondiiME49 poly(ADP)-ribose polymerase domain-containing

99%

15

L06091.1

TOXGRA5A

dense granule precursor (GRA5) gene

Toxoplasma gondii strain RH clone pcGRA5-IR dense granule antigen

100%

16

AM055943.1 7896316

TGME49_008440

cytoplasmic protein Cyt16

Toxoplasma gondii RH genomic DNA chromosome Ib, cytoplasmic protein Cyt16 (cyt16) gene, complete cds

93%

17

7894239

TGME49_054870

hypothetical protein

Toxoplasma gondiiME49 hypothetical protein

89%

18

7896580

TGME49_008830

hypothetical protein

Toxoplasma gondiiME49 hypothetical protein

91%

19

7899034

TGME49_057360

Hypothetical protein

Toxoplasma gondiiME49 hypothetical protein

99%

20

7899034

TGME49_057360

hypothetical protein

Toxoplasma gondiiME49 hypothetical protein

99%

21

AY707938.1

TGME49_071050

SRS34A (= SAG2A, P22)

Toxoplasma gondii ME49 surface antigen P22 3′ flanking sequence

100%

22

7894324

TGME49_030180

hypothetical protein

Toxoplasma gondii ME49 hypothetical protein

98%

23

AF364813.1

TGME49_014940

MIC2-associated protein M2AP

Toxoplasma gondii ME49 MIC2-associated protein precursor, gene, complete cds

99%

24

7900910

TGME49_066900

cyclin, N-terminal domain-containing protein

Toxoplasma gondiiME49 cyclin, N-terminal domain-containing protein, mRNA

100%

25

7895521

TGME49_058470

Hypothetical protein

Toxoplasma gondiiME49 hypothetical protein

99%

26

AM055943.1 7896316

TGME49_008440

hypothetical protein

Toxoplasma gondii RH genomic DNA chromosome Ib

98%

27

7897539

TGME49_116540

Hypothetical protein

Toxoplasma gondiiME49 hypothetical protein

97%

28

7895127

TGME49_027280

dense granule protein 3

Toxoplasma gondii ME49 dense granule protein 3, mRNA

90%

29

AM055943.1 7896796

TGME49_121620

dynamic-like protein

Toxoplasma gondii RH genomic DNA chromosome Ib

96%

Table 4

Toxoplasma gondii IVIAT- identified genes by immunoscreening of cDNA library using anti-human IgG-HRP

GenBank ID/accession no.

Gene ID in Toxo DB

Gene name

Description

Homology percentage

1

7901108

TGME49_069250

26S proteasome regulatory subunit

Toxoplasma gondii ME49 26S proteasome regulatory subunit, putative

95%

2

7901478

TGME49_097940

hypothetical protein

Toxoplasma gondiiME49 hypothetical protein

99%

3

7894322

TGME49_030160

hypothetical protein

Toxoplasma gondiiME49 hypothetical protein

93%

4

7894761

TGME49_061750

hypothetical protein

Toxoplasma gondiiME49 hypothetical protein

98%

5

7897485

TGME49_005180

U1 small nuclear ribonucleoprotein

Toxoplasma gondii ME49 U1 small nuclear ribonucleoprotein, putative

95%

6

7899395

TGME49_037230

hypothetical protein

Toxoplasma gondiiME49 hypothetical protein

80%

7

7895435

TGME49_024460

aminopeptidase N

Toxoplasma gondii ME49 aminopeptidase N, putative

82%

8

7895096

TGME49_027910

hypothetical protein

Toxoplasma gondiiME49 hypothetical protein

95%

9

7895077

TGME49_025560

hypothetical protein

Toxoplasma gondiiME49 hypothetical protein

99%

10

7897605

TGME49_025080

40S ribosomal protein S18

Toxoplasma gondii ME49 40S ribosomal protein S18, putative

84%

11

7899217

TGME49_068830

hypothetical protein

Toxoplasma gondiiME49 hypothetical protein

94%

12

AM055942.3

TGME49_095420

hypothetical protein

Toxoplasma gondii RH genomic DNA chromosome Ia

87%

13

7894058

TGME49_002840

zinc finger (C3HC4 type)

Toxoplasma gondii ME49 zinc finger (C3HC4 type)/FHA domain-containing protein

97%

14

7893896

TGME49_075310

hypothetical protein

Toxoplasma gondiiME49 hypothetical protein

94%

15

7899266

TGME49_047530

hypothetical protein

Toxoplasma gondiiME49 hypothetical protein

96%

16

7893521

TGME49_018520

protein MIC6

Toxoplasma gondii micronemal protein MIC6 (MIC6) mRNA, complete

95%

17

7893531

TGME49_018720

protein kinase

Toxoplasma gondii ME49 calcium-dependent protein kinase, putative

91%

18

7896164

TGME49_025060

nucleoredoxin

Toxoplasma gondii ME49 nucleoredoxin, putativ

98%

19

7896097

TGME49_026520

hypothetical protein

Toxoplasma gondiiME49 hypothetical protein

98%

20

7901507

TGME49_078510

Protein phosphatase 2C

Toxoplasma gondii ME49 protein phosphatase 2C, putative

95%

21

7894761

TGME49_061750

hypothetical protein

Toxoplasma gondiiME49 hypothetical protein

98%

22

7900407

TGME49_078450

hypothetical protein

Toxoplasma gondiiME49 hypothetical protein

95%

23

7897848

TGME49_095620

zinc finger (CCCH type)

Toxoplasma gondii ME49 zinc finger (CCCH type) protein, putative

91%

24

7900113

TGME49_035990

hypothetical protein

Toxoplasma gondiiME49 hypothetical protein

91%

25

7899268

TGME49_045880

hypothetical protein

Toxoplasma gondiiME49 hypothetical protein

88%

26

7893794

TGME49_067740

hypothetical protein

Toxoplasma gondiiME49 hypothetical protein

99%

27

7893464

TGME49_071050

surface antigen P22

Toxoplasma gondii strain 14 surface antigen P22 3′ flanking sequence

85%

28

7899477

TGME49_049670

cysteine proteinase

Toxoplasma gondii ME49 cysteine proteinase (cp1) mRNA, complete cds

95%

29

AY424892.1

AY424892.1

UDP-N-acetyl-D-galactosamine

Toxoplasma gondii UDP-N-acetyl-D galactosamine:polypeptide N-acetylgalactosaminyltransferase T3 gene, complete cds

90%

Assessment of IVIAT-identified gene expression by real-time PCR

Due to the large number of samples in this study and the use of different control samples for each round of experiments, the detailed data could not be placed in one table. Therefore only the fold changes of the examined sequences are presented in Tables 5 and 6 to show the relative expression levels between in-vivo and in-vitro grown parasites for IgM-detected sequences and IgG-detected sequences respectively. Of the 29 IgM-detected genes analyzed, 20 (69%) were up-regulated in-vivo relative to their in-vitro expression levels with fold changes between 3.11 and 330.8 (Figure 2A). Table 5 shows the fold changes of the expression of the genes; the results indicated that there were significant increases, ranging from 3.11 to 330.8-folds of the gene expression levels of in-vivo over in-vitro grown parasites for 20 of 28 IgM-detected genes. Of the 29 IgG-detected genes analyzed, 10 (34%) were up-regulated in-vivo relative to their expression levels in-vitro with fold changes between 1.59 and 499.86 (Figure 2B). Table 6 shows the fold changes of the expression of the genes; the results indicated that there were significant increases, ranging from 1.31 to 449.86-folds of the expression levels of in-vivo over in-vitro for 11 of 29 IgG-detected genes.
Table 5

Relative mRNA expression levels of T.gondii IVIAT-identified genes detected by IgM using 2 - ΔΔ Ct method

No

GenBank ID

Fold change

Protein encoded by gene

1

7895406

0.86

 

2

7898829

330.8

hypothetical protein

3

7894091

0.97

 

4

7900912

0.14

 

5

7899945

0.00048

 

6

7893976

0.6

 

7

7893824

53.81

sterol-regulatory element binding protein site

8

7899621

8.6

 

9

7901413

35.75

microneme

10

7894150

25.28

hypothetical protein

11

7895338

179.76

hypothetical protein

12

7898197

43.11

hypothetical protein

13

7895974

8.87

 

14

7900011

0.62

 

15

L06091.1

3.6

 

16

7896316

0.3

 

17

7894239

3.22

 

18

7896580

4.89

 

19

7899034

0.09

 

20

7899034

0.26

 

21

AY707938.1

27.28

SRS34A

22

7894324

32.89

hypothetical protein

23

AF364813.1

22.6

MIC2-associated protein M2AP

24

7900910

6.82

 

25

7895521

3.78

 

26

7896316

0.24

 

27

7897539

6.49

 

28

7895127

3.11

 

29

7896796

8.5

 
Table 6

Relative mRNA expression levels of T.gondii IVIAT-identified genes detected by IgG using 2 - ΔΔ Ct method

No

GenBank ID

Fold change

protein encoded by gene which are upregulated >10 ×

1

7901108

1.67

 

2

7901478

0.80

 

3

7894322

1.31

 

4

7894761

0.33

 

5

7897485

0.36

 

6

7899395

0.05

 

7

7895435

0.01

 

8

7895096

0.16

 

9

7895077

0.98

 

10

7897605

0.18

 

11

7899217

3.03

 

12

AM055942.3

60.97

hypothetical protein

13

7894058

0.01

 

14

7893896

0.05

 

15

7899266

499.86

hypothetical protein

16

7893521

1

 

17

7893531

2.84

 

18

7896164

30.70

nucleoredoxin

19

7896097

2.15

 

20

7901507

14.86

Protein phosphatase 2C

21

7894761

0.18

 

22

7900407

1.59

 

23

7897848

1.75

 

24

7900113

0.1

 

25

7899268

0.08

 

26

7893794

0.23

 

27

7893464

0.01

 

28

7899477

0.02

 

29

AY424892.1

0.02

 
Figure 2
Figure 2

Relative gene expression level ( in-vivo to in-vitro ) for T.gondii genes identified by IVIAT. (A). Genes detected by IgM antibody (B). Genes detected by IgG antibody. The y axis presented the identified genes by number.

Sensitivity and specificity evaluation

The top three most up-regulated IgM- and IgG-detected clones were subjected to sensitivity and specificity analysis. Figure 3 shows an example of the immunoblot results, and Table 7 shows the summary of the results. High sensitivity (90.0%) was observed for three IgM-detected clones and one of the IgG-detected clones. However the specificity was generally not high, the best was a moderate specificity of 70% from a hypothetical protein expressed by an IgM-detected clone (GenBank accession no. 7898829).
Figure 3
Figure 3

Representative results of sensitivity evaluation of clone which expressed sterol-regulatory element binding protein site. AS1-AS4: serum from persons with acute toxoplasmosis. HC: serum from healthy person.

Table 7

Sensitivity and specificity results for three up-regulated IgM and IgG-detected clones identified by IVIAT

GenBank ID

Fold change

Sensitivity

Specificity

Antibody detection

7898829

330.8

90% (9/10)

70% (7/10)

IgM

7893824

53.81

90% (9/10)

50% (5/10)

IgM

7895338

179.76

90% (9/10)

40% (4/10)

IgM

AM055942.3

60.97

60% (6/10)

60% (6/10)

IgG

7899266

499.86

60% (6/10)

70% (7/10)

IgG

7896164

30.70

90% (9/10)

60% (6/10)

IgG

Discussion

IVIAT has been applied in the study of several pathogenic microorganisms based on the assumption that conventional genetic and biochemical in-vitro approaches cannot mimic the real complex and dynamic in-vivo situation of human infection [1928]. In our recent published report, T.gondii genes preferentially expressed in-vivo were identified via immunoscreening of T.gondii expression library with sera from chronically-infected individuals followed by real time PCR to confirm the up-regulation of the identified genes. There were increased expression levels of RNA of three genes i.e. SRS3 and two hypothetical protein genes from in-vivo grown T.gondii relative to the same genes from in-vitro grown parasite [13]. This approach does not reflect all of the antigens that are produced in-vivo by the eukaryotic parasite, considering that a prokaryotic expression system was used in constructing the cDNA library. Nevertheless, this approach would be expected to identify some of the in-vivo induced antigens of the parasite [13].

The rationale for use of in-vitro instead of in-vivo grown T. gondii has been explained in our previous report [13]. A large quantity of ‘clean tachyzoites’ was needed to make a good high titre T. gondii cDNA library. As compared to the use of mice as host, the in-vitro method had less contamination and produced higher quantity of parasites in a shorter period of time. Although all the RNA may not be exactly the same between in-vivo and in vitro grown parasites, there should be substantial similarities between them to enable us to observe difference in expression levels between them. Moreover IVIAT was introduced in order to reduce the need to use animals. There are also many other IVIAT studies which used in-vitro grown organisms [16, 20, 29, 30]. For the same reasons (i.e. better purity and yield), we used T. gondii RH strain instead of ME49 strain, although the available genome information was derived from the latter.

The main serological marker for the diagnosis of acute toxoplasmosis is specific IgM antibody, along with IgG antibody of low avidity [31]. In the present study 29 T. gondii sequences were detected by each IgM and IgG secondary antibodies using sera from individuals with serological evidence of acute infection. Due to resource constraints, we did not endeavour to identify all of the IVIAT-detected clones using a high-throughput methodology. However the random selection of the clones for expression analysis by real-time PCR hopefully will provide a ‘snapshot’ of the in-vivo induced antigens of T. gondii. The results of the transcriptional profiling suggested the induction of genes that have been described as involved in parasite invasion and motility, cellular metabolism, as well as other unknown functions. It is notable that the percentage of up-regulated genes among the IgM-identified clones were twice the percentage of up-regulated genes among the IgG-identified clones. It is also interesting to note that among the IgM and IgG-detected proteins, most were hypothetical proteins namely 14 of 29 and 16 of 29 respectively. Limited sensitivity and specificity evaluation of the top three most up-regulated IgM- and IgG-detected clones showed that none had good specificity, thus further testing with more serum samples were not performed.

Three different microneme proteins namely MIC6, MIC11, MIC13 and a MIC2 associated protein were identified in this study. MIC6 showed no difference in the mRNA expression levels in-vivo over in-vitro, but the other three genes detected by IgM (MIC11, MIC13 and MIC2 associated protein) showed significant increases of mRNA expression level of in-vivo grown T.gondii in comparison to in-vitro grown T. gondii. Micronemes are sub-cellular organelles that belong to apicomplexan protozoans which secrete proteins (MICs) known to be responsible for the gliding motility and subsequent invasion process of T. gondii[32]. MIC11 is a conserved microneme protein in apicomplexan protozoans that is secreted in a calcium dependent manner while MIC13 has been reported as a successful vaccine candidate against chronic infection and congenital toxoplasmosis in mice [33, 34]. In this study, the increased expression levels of MIC11, MIC13 and a MIC2 associated protein mRNA observed in the in-vivo grown tachyzoites may be due to their role in attachment and invasion of the tachyzoites in the host during acute infection.

Meanwhile, sequences of DNA chromosome Ιb were detected by IgM whereby three sequences which code a dynamic-like protein, a hypothetical protein and cyclin-N terminal domain showed increased level of mRNA expression of in-vivo grown over in-vitro grown T. gondii. Besides, a high increase in the mRNA expression levels (60.67 fold change) was observed for DNA chromosome Ιa sequence that was detected by IgG. Comparative studies between the chromosome genomes of T. gondii RH Type I and ME49 Type II strains revealed polymorphisms at a frequency of ~1 in 100 bp among all chromosomes except chromosome Ia (chrIa). Chromosome Ia has the same gene content and structural elements in both strains and this suggest that chrIa has monomorphic inheritance compared to the rest of the T. gondii chromosomes for all three clonal lineages although the biological basis remains unknown. The unusual monomorphism of chrIa has led us to the conclusion that genes located on this chromosome may allow some fitness advantage [35].

Eleven other genes with more than 10 times fold changes include nucleoredoxin, protein phosphatase 2C, sterol regulatory protein, surface antigen P22 3’ flanking sequence [SRS34A (= SAG2A, P22)] and six ORF coding hypothetical proteins. We were most intrigued by the observation of a very high expression level for one of the up-regulated genes detected by IgG, with in-vivo over in-vitro fold change of 499.86. Unfortunately the function of the gene is unknown. Nucleoredoxin (NRX) is a novel gene which encodes a protein similar to ATrx1, a member of thioredoxins (TRX) family. Nucleoredoxin is highly conserved in all the kingdoms of living organisms and was formerly reported to be nuclear and more recently cytosolic. It appears to play a role in signal transduction and may be a redox regulator factor of the nuclear proteins [36, 37].

Protein phosphatase 2C (PP2C) is a Mn2+ or Mg2 -dependent protein Ser/Thr phosphatase secreted by rhoptry, a secretory organelle of T. gondii. It was identified in a proteomic survey of rhoptry proteins (ROPs), and found to be essential for the invasion process of apicomplexan parasites [38]. Host cell invasion and motility in apicomplexa protozoa occurs through actin polymerization as the main process. Actin monomers and their cap filaments in T. gondii are secreted by toxofilins and its activities in-vitro and in-vivo are dependent on phosphorylation of this protein. Recently a type 2C phosphatase has been reported to be involved in toxifilin phosphorylation and activity [39].

Sterol regulatory element-binding proteins (SREBPs) were found to be one of the three most up-regulated sequences detected by IgM in this study. SREBPs are basic-helix-loop-helix leucine zipper class of transcription factors which are specific for fatty acid and cholesterol synthesis. When the level of sterols is low, SREBPs are cleaved to a water soluble N-terminal domain which is then translocated to the nucleus [40].

SRS34A (= SAG2A, P22), is a plasma membrane gene of T. gondii found during and after tachyzoite invasion. SAG family of proteins which cover the surface of T. gondii bradyzoites and tachyzoites comprise five main members i.e. SAG1 (P30 kDa), SAG2 (P22 kDa), SAG3 (P43 kDa), SAG4 (P23 kDa) and SAG5 (P35 kDa) [41, 42]. SAG1 and SAG2A are immunodominant within the superfamily and induce a high antibody response in early infection. The increased mRNA expression level of SRS34A (SAG2A) which has been detected by IgM in this study is in agreement with other studies which reported that tachyzoite surface is dominated by SAG1, SAG2A, SAG3, SRS1, SRS2 and SRS3 and have been shown to be involved in attachment and invasion necessary for early acute T. gondii infection [43].

Conclusion

This study identified several T. gondii genes with up-regulated expression in-vivo as compared to in-vitro. Further studies including stage-specific expression and localisation studies on the highly up-regulated genes and the corresponding proteins, in particular the hypothetical proteins, should be performed. This may help to increase our understanding of the disease pathogenesis and asses their usefulness as potential vaccine candidates.

Declarations

Acknowledgements

This study was funded by Science Fund from Ministry of Science and Innovation, No. 02-01-05-SF0428 and USM Research University grant No: 1001/CIPPM/8130132. The first author received financial support from USM Graduate Assistant scheme.

Authors’ Affiliations

(1)
Institute for Research in Molecular Medicine (INFORMM), Universiti Sains Malaysia (USM), Penang, Malaysia
(2)
Parasitology Department, Molecular Parasitology Laboratory, Pasteur Institute of Iran, Tehran, Iran

References

  1. Kopečná J, Jirků M, Oborník M, Tokarev YS, Lukeš J, Modrỳ D: Phylogenetic analysis of coccidian parasites from invertebrates: search for missing links. Protist. 2006, 157: 173-183. 10.1016/j.protis.2006.02.005.View ArticlePubMedGoogle Scholar
  2. Torda A, Torda A: Toxoplasmosis. Are cats really the source?. Aust Fam Physician. 2001, 30: 743-747.PubMedGoogle Scholar
  3. Montoya J, Liesenfeld O: Toxoplasmosis. Lancet. 2004, 363 (9425): 1965-1976. 10.1016/S0140-6736(04)16412-X.View ArticlePubMedGoogle Scholar
  4. Kapperud G, Jenum PA, Stray-Pedersen B, Melby KK, Eskil A, Eng J: Risk factors for Toxoplasma gondii infection in pregnancy. Results of a prospective case–control study in Norway. Am J Epidemiol. 1996, 144: 405-412. 10.1093/oxfordjournals.aje.a008942.View ArticlePubMedGoogle Scholar
  5. Sukthana Y: Toxoplasmosis beyond animal and humans. Trends Parasitol. 2006, 22 (3): 137-142. 10.1016/j.pt.2006.01.007.View ArticlePubMedGoogle Scholar
  6. Gilbert RE, Peckham CS: Congenital toxoplasmosis in the United Kingdom: to screen or not to screen?. J Med Screen. 2002, 9: 135-141. 10.1136/jms.9.3.135.View ArticlePubMedGoogle Scholar
  7. Andrade GM, Resende LM, Goulart EM, Siqueira AL, Vitor RW, Januario JN: Hearing loss in congenital toxoplasmosis detected by newborn screening. Braz J Otorhinolaryngol. 2008, 74: 21-28.View ArticlePubMedGoogle Scholar
  8. McLeod R, Kieffer F, Sautter M, Hosten T, Pelloux H: Why prevent, diagnose and treat congenital toxoplasmosis?. Mem Inst Oswaldo Cruz. 2009, 104: 320-344. 10.1590/S0074-02762009000200029.View ArticlePubMedPubMed CentralGoogle Scholar
  9. Liesenfeld O, Montoya JG, Kinney S, Press C, Remington JS: Effect of testing for IgG avidity in the diagnosis of toxoplasma gondii infection in pregnant women: experience in a US reference laboratory. J Infec Disease. 2001, 183: 1248-1253. 10.1086/319672.View ArticleGoogle Scholar
  10. Handfield M, Brady LJ, Progulske-Fox A, Hillman JD: IVIAT: a novel method to identify microbial genes expressed specifically during human infections. Trends Microbiol. 2000, 8: 336-339. 10.1016/S0966-842X(00)01775-3.View ArticlePubMedGoogle Scholar
  11. Angelichio MJ, Camilli A: In vivo expression technology. Infect Immun. 2002, 70: 6518-6523. 10.1128/IAI.70.12.6518-6523.2002.View ArticlePubMedPubMed CentralGoogle Scholar
  12. Lowe AM, Beattie DT, Deresiewicz RL: Identification of novel staphylococcal virulence genes by in vivo expression technology. Mol Microbiol. 1998, 27: 967-976. 10.1046/j.1365-2958.1998.00741.x.View ArticlePubMedGoogle Scholar
  13. Amerizadeh A, Idris ZM, Khoo BY, Kotresha D, Yunus MH, Abdul Karim IZ, Saadatnia G, Teh AY, Noordin R: Identification of Toxoplasma gondii in-vivo induced antigens by cDNA library immunoscreening with chronic toxoplasmosis sera. Microb Pathog. 2013, 54: 60-66.View ArticlePubMedGoogle Scholar
  14. Saadatnia G, Haj Ghani H, Khoo BY, Maimunah A, Noordin R: Research note optimization of toxoplasma gondii cultivation in VERO cell line. Trop Biomed. 2010, 27: 125-130.PubMedGoogle Scholar
  15. Rollins SM, Peppercorn A, Hang L, Hillman JD, Calderwood SB, Handfield M: In vivo induced antigen technology (IVIAT). Cell Microbiol. 2005, 7 (1): 1-9.View ArticlePubMedGoogle Scholar
  16. Hang L, John M, Asaduzzaman M, Bridges EA, Vanderspurt C, Kirn TJ, Taylor RK, Hillman JD, Progulske-Fox A, Handfield M, Ryan ET, Calderwood SB: Use of in vivo-induced antigen technology (IVIAT) to identify genes uniquely expressed during human infection with Vibrio cholerae. P Natl Acad Sci USA. 2003, 100: 8508-8513. 10.1073/pnas.1431769100.View ArticleGoogle Scholar
  17. Khan A, Taylor S, Su C, Mackey AJ, Boyle J, Cole R, Glover D, Tang K, Paulsen IT, Berriman M, Boothroyd JC, Pfefferkon ER, Dubey JP, Ajioka JW, Roos DS, Wootton JC, Sibely LD: Composite genome map and recombination parameters derived from three archetypal lineages of Toxoplasma gondii. Nucleic Acids Res. 2005, 33: 2980-2992. 10.1093/nar/gki604.View ArticlePubMedPubMed CentralGoogle Scholar
  18. Livak KJ, Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCT method. Methods. 2001, 25: 402-408. 10.1006/meth.2001.1262.View ArticlePubMedGoogle Scholar
  19. Vigil PD, Alteri CJ, Mobley HLT: Identification of in vivo-induced antigens including an RTX family exoprotein required for uropathogenic Escherichia coli virulence. Infect Immun. 2011, 79: 2335-2344. 10.1128/IAI.00110-11.View ArticlePubMedPubMed CentralGoogle Scholar
  20. Lee HR, Rhyu IC, Kim HD, Jun HK, Min BM, Lee SH, Chio BK: In-vivo-induced antigenic determinants of Fusobacterium nucleatum subsp. nucleatum. Mol Oral Microbiol. 2011, 26: 167-172.View ArticleGoogle Scholar
  21. Cao SL, Progulske-Fox A, Hillman JD, Handfield M: In vivo induced antigenic determinants of Actinobacillus actinomycetemcomitans. FEMS Microbiol Lett. 2004, 237: 97-103. 10.1111/j.1574-6968.2004.tb09683.x.View ArticlePubMedGoogle Scholar
  22. Kumar M, Khan FG, Sharma S, Kumar R, Faujdar J, Sharma R, Chauhan DS, Singh R, Magotra SK, Khan IA: Identification of Mycobacterium tuberculosis genes preferentially expressed during human infection. Microb Pathogenesis. 2011, 50: 31-38. 10.1016/j.micpath.2010.10.003.View ArticleGoogle Scholar
  23. Vernati G, Edwards W, Rocke T, Little S, Andrews G: Antigenic profiling of Yersinia pestis infection in the Wyoming coyote (Canis latrans). J Wildlife Dis. 2011, 47: 21-29.View ArticleGoogle Scholar
  24. Deb D, Dahiya P, Srivastava K, Srivastava R, Srivastava B: Selective identification of new therapeutic targets of Mycobacterium tuberculosis by IVIAT approach. Tuberculosis. 2002, 82: 175-182. 10.1054/tube.2002.0337.View ArticlePubMedGoogle Scholar
  25. Kim YR, Lee SE, Kim CM, Kim SY, Shin EK, Shin DH, Chung SS, Progulske-Fox JD, Handfield M, Rhee JH: Characterization and pathogenic significance of Vibrio vulnificus antigens preferentially expressed in septicemic patients. Infect Immun. 2003, 71: 5461-5471. 10.1128/IAI.71.10.5461-5471.2003.View ArticlePubMedPubMed CentralGoogle Scholar
  26. Harris JB, Baresch-Bernal A, Rollins SM, Alam A, LaRocque RC, Bikowski M, Peppercorn AF, Handfield M, Hillman JD, Qadri F, Calderwood SB, Hohmann E, Breiman RF, Brooks WA, Ryan ET: Identification of in vivo-induced bacterial protein antigens during human infection with Salmonella enterica serovar Typhi. Infect Immun. 2006, 74: 5161-5168. 10.1128/IAI.00488-06.View ArticlePubMedPubMed CentralGoogle Scholar
  27. John M, Kudva IT, Griffin RW, Dodson AW, McManus B, Krastins B, Sarracino D, Progulske-Fox A, Hillman JD, Handfield M, Tarr PI, Calderwood SB: Use of in vivo-induced antigen technology for identification of Escherichia coli O157:H7 proteins expressed during human infection. Infect Immun. 2005, 73: 2665-2679. 10.1128/IAI.73.5.2665-2679.2005.View ArticlePubMedPubMed CentralGoogle Scholar
  28. Zou YX, Mo ZL, Hao B, Ye XH, Guo DS, Zhang PJ: Screening of genes expressed in vivo after infection by Vibrio anguillarum M3. Lett App Microbiol. 2010, 51: 564-569. 10.1111/j.1472-765X.2010.02935.x.View ArticleGoogle Scholar
  29. Salim KY, Cvitkovitch DG, Chang P, Bast DJ, Handfield M, Hillman JD, de Azavedo JC: Identification of group a streptococcus antigenic determinants unregulated in vivo. Infect Immun. 2005, 73 (9): 6026-6038. 10.1128/IAI.73.9.6026-6038.2005.View ArticlePubMedPubMed CentralGoogle Scholar
  30. Nogueira SV, Fonseca FL, Rodrigues ML, Mundodi V, Abi-Chacra EA, Winters MS, Alderete JF, de Almeida Soares CM: Paracoccidioides brasiliensis enolase is a surface protein that binds plasminogen and mediates interaction of yeast forms with host cells. Infect Immun. 2010, 78 (9): 4040-4050. 10.1128/IAI.00221-10.View ArticlePubMedPubMed CentralGoogle Scholar
  31. Araujo PRB, Ferreira AW: High diagnostic efficiency of IgM-ELISA with the use of multiple antigen peptides (MAP1) from T. gondii ESA (SAG-1, GRA-1 and GRA-7) in acute toxoplasmosis. Rev Inst Med Trop Sao Paulo. 2010, 52 (2): 63-68. 10.1590/S0036-46652010000200001.View ArticlePubMedGoogle Scholar
  32. Carruthers VB, Tomley FM: Microneme proteins in apicomplexans. Subcell Biochem. 2008, 47: 33-45. 10.1007/978-0-387-78267-6_2.View ArticlePubMedPubMed CentralGoogle Scholar
  33. El Haji H, Papoin J, Cérède O, Garcia-Réguet N, Soête M, Dubremetz JF, Lebrun M: Molecular signals in the trafficking of Toxoplasma gondii protein MIC3 to the micronemes. Eukaryot Cell. 2008, 7: 1019-1028. 10.1128/EC.00413-07.View ArticleGoogle Scholar
  34. Ren D, Zhou DH, Xu MJ, Zhou Y, Yang JF, Lin ZP, Lin RQ, Wu SM, Lin SQ, Zou FC, Yuan ZG: Sequence variation in Toxoplasma gondii MIC13 gene among isolates from different hosts and geographical locations. African Journal of Microbiology Research. 2012, 6 (13): 1333-1337.Google Scholar
  35. Khan A, Su C, German M, Storch GA, Clifford DB, David Sibley L: Genotyping of toxoplasma gondii strains from immunocompromised patients reveals high prevalence of type I strains. J Clin Microbiol. 2005, 43: 5881-5887. 10.1128/JCM.43.12.5881-5887.2005.View ArticlePubMedPubMed CentralGoogle Scholar
  36. Funato Y, Miki H: Nucleoredoxin, a novel thioredoxin family member involved in cell growth and differentiation. Antioxid Redox Signal. 2007, 9 (8): 1035-1057. 10.1089/ars.2007.1550.View ArticlePubMedGoogle Scholar
  37. Das AK, Helps NR, Cohen PT, Barford D: Crystal structure of the protein serine/threonine phosphatase 2C at 2.0 A resolution. EMBO J. 1996, 15 (24): 6798-6809.PubMedPubMed CentralGoogle Scholar
  38. Bradley PJ, Sibley LD: Rhoptries: an arsenal of secreted virulence factors. Curr Opin Microbiol. 2007, 10: 582-587. 10.1016/j.mib.2007.09.013.View ArticlePubMedPubMed CentralGoogle Scholar
  39. Shimano H: Sterol regulatory element-binding proteins (SREBPs): transcriptional regulators of lipid synthetic genes. Prog Lipid Res. 2001, 40 (6): 439-452. 10.1016/S0163-7827(01)00010-8.View ArticlePubMedGoogle Scholar
  40. Grimwood J, Smith JE: Toxoplasma gondii: redistribution of tachyzoite surface protein during host cell invasion and intracellular development. Parasitol Res. 1995, 81 (8): 657-661. 10.1007/BF00931842.View ArticlePubMedGoogle Scholar
  41. Lekutis C, Ferguson DJP, Grigg ME, Camps M, Boothroyd JC: Surface antigens of Toxoplasma gondii: variations on a theme. Int J Parasitol. 2001, 31: 1285-1292. 10.1016/S0020-7519(01)00261-2.View ArticlePubMedGoogle Scholar
  42. Dzierszinski F, Mortuaire M, Cesbron Delauw MF, Tomavo S: Targeted disruption of the glycosylphosphatidylinositol anchored surface antigen SAG3 gene in Toxoplasma gondii decreases host cell adhesion and drastically reduces virulence in mice. Mol Microbiol. 2000, 37: 574-582.View ArticlePubMedGoogle Scholar
  43. Jacquet A, Coulon L, De Nève J, Daminet V, Haumont M, Garcia L, Bollen A, Jurado M, Biemans R: The surface antigen SAG3 mediates the attachment of Toxoplasma gondii to cell-surface proteoglycans. Mol Biochem Parasitol. 2001, 116: 35-44. 10.1016/S0166-6851(01)00297-3.View ArticlePubMedGoogle Scholar
  44. Pre-publication history

    1. The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1471-2334/13/287/prepub

Copyright

© Amerizadeh et al.; licensee BioMed Central Ltd. 2013

This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Advertisement