You are viewing the site in preview mode

Skip to main content

Advertisement

Table 1 DNA samples were genotyped by using Taqman commercial probes

From: Pandemic influenza A/H1N1 virus infection and TNF, LTA, IL1B, IL6, IL8, and CCLpolymorphisms in Mexican population: a case–control study

Gene (reference SNP) Probe
TNF (rs1800750) GAGGCAATAAGACCCCCCTCGGAATC[A/G]GAGCAGCTGTCAATTGCAGGAGCT
TNF (rs1800629) GAGGCAATAGGTTTTGAGGGGCATG[A/G]GGACGGGGTTCAGCCTCCAGGGTCC
TNF (rs361525) GGCCCAGAAGACCCCCCTCGGAATC[A/G]GAGCAGGGAGGATGGGGAGTGTGA
LTA (rs909253) AAGCCTTAAAACCTAGGGCATACA[C/T]TTGATAATTCACCCTCCAGGGTCCGTT
IL1B (rs16944) TACCTTGGGTGCTGTTCTCTGCCTC[G/A]GGAGCTCTCTGTCAATTGCAGGAGC
IL6 (rs1818879) AGACGAGCTGGGCGCAGTGGCTCAC[A/G]CCTATAATCCCAGCACTTTGGGAGG
IL8 (rs4073) TTATCTAGAAATAAAAAAGCATACA[A/T]TTGATAATTCACCAAATTGTGGAGC
CCL1 (rs2282691) AAAAAGCCTTAAAATACTGACTGGT[A/T]TGTGAAAGCTACTCCAATTAAGTTT
  1. SNP Single nucleotide polymorphisms.