You are viewing the site in preview mode

Skip to main content

Advertisement

Table 1 Primer sequences and probes used in real-time PCR assay

From: Excessive proinflammatory cytokine and chemokine responses of human monocyte-derived macrophages to enterovirus 71 infection

Gene Primer and probe sequence (5′to3′) Product length(bp) GenBank
EV71 (R) CCCGCTCTGCTGAAGAAACT 89 AF302996
  (F)AGTGATGAGAGTATGATTGAGACACG   
  (P) TCGCACAGCACAGCTGAGACCACTC   
β-actin (R) CAAGTACTCCGTGTGGATCG 90 NM_001101.3
  (F) GGATGCAGAAGGAGATCACTG   
  (P) CCCTGGCACCCAGCACAATGA   
RIG-1 (R) CCTCTGCACTGTTGCTCAGGAC 192 NM_004585.3
  (F) CTCTTGGCTTCGAGATGGCTTC   
MDA5 (R) ATTGGTGACGAGACCATAACGGATA 196 NM_022168.2
  (F) AGGAGTCAAAGCCCACCATCTG   
TLR2 (R) CACAAAGTATGTGGCATTGTCCAG 158 NM_003264.3
  (F) GTGTTGCAAGCAGGATCCAAAG   
TLR3 (R) AGTGCCGTCTATTTGCCACACA 181 NM_003265.2
  (F) AACAGTGCACTTGGTGGTGGAG   
TLR4 (R) ATGCGGACACACACACTTTCAAATA 143 NM_138554.3
  (F) TTGAGCAGGTCTAGGGTGATTGAAC   
TLR6 (R) AGCCTTCAGCTTGTGGTACTTGTTG 138 NM_006068.2
  (F) CAGAGTGAGTGGTGCCATTACGA   
TLR7 (R) TCTTCAACCAGACCTCTACATTCCA 172 NM_016562.3
  (F) GGAACATCCAGAGTGACATCACAG   
TLR8 (R) GATTGCTGCACTCTGCAATAACTGA 196 NM_138636.3
  (F) GCTGCTGCAAGTTACGGAATGA   
TLR9 (R) CAGGGCCTTCAGCTGGTTTC 97 NM_017442.2
  (F) CCGTGACAATTACCTGGCCTTC   
TLR10 (R) TGTGTTGCAAGATAATTCGTGGAGA 103 NM_001017388.1
  (F) CATGATGGTTGGATGGTCAGATTC   
β-actin (R) CTAAGTCATAGTCCGCCTAGAAGCA 186 NM_001101.3
  (F) TGGCACCCAGCACAATGAA