You are viewing the site in preview mode

Skip to main content

Advertisement

Table 3 Primer and probe sequences for the respiratory multiplex rtPCR

From: During the summer 2009 outbreak of "swine flu" in Scotland what respiratory pathogens were diagnosed as H1N1/2009?

Multiplex Virus Target Target Gene Forward primer sequence Reverse primer sequence Probe sequence
1 Influenza B NS ATGATCTTACAGTGGAGGATGAAGAA CGAATTGGCTTTGRATGTCCTT CY5-ATGGCCATCGGATCCTCAAYTCACTCT-BHQ
  Influenza C Matrix GGCAAGCGACATGCTGAAYA TCCAGCTGCYTTCATTTGCTTT VIC-CTCTTCCTTCTGATTTTTTCAAA-MGBNFQ
2 Mycoplasma pneumoniae Cytadhesin P1 (P1) gene AAGCAGGAGTGACGGAAACAC CACCACATCATTCCCCGTATT CY5-CTCCACCAACAACCTCGCGCCTA-BHQ
  Human metapneumovirus A Fusion GCYGTYAGCTTCAGTCAATTCAA TCCAGCATTGTCTGAAAATTGC VIC-CAACATTTAGAAACCTTCT-MGBNFQ
  Human metapneumovirus B Fusion GCYGTYAGCTTCAGTCAATTCAA (Common with A) GTTATCCCTGCATTGTCTGAAAACT VIC-CGCACAACATTTAGGAATCTTCT-MGBNFQ
  Parainfluenza virus 1 HN GTGATTTAAACCCGGTAATTTCTCA CCTTGTTCCTGCAGCTATTACAGA FAM-ACCTATGACATCAACGAC-MGBNFQ
3 Parainfluenza virus 2 HN ATGAAAACCATTTACCTAAGTGATGGA CCTCCYGGTATRGCAGTGACTGAAC VIC-TCAATCGCAAAAGC-MGBNFQ
  Parainfluenza virus 3 HN CCAGGGATATAYTAYAAAGGCAAAA CCGGGRCACCCAGTTGTG FAM-TGGRTGTTCAAGACCTCCATAYCCGAGAAA-BHQ
  Parainfluenza virus 4 Fusion CAGAYAACATCAATCGCCTTACAAA TGTACCTATGACTGCCCCAAARA CY5-CCMATCACAAGCTCAGAAATYCAAAGTCGT-BHQ3A
4 Human coronavirus 229E Nucleocapsid CAGTCAAATGGGCTGATGCA AAAGGGCTATAAAGAGAATAAGGTATTCT FAM-CCCTGACGACCACGTTGTGGTTCA- BHQ
  Human coronavirus OC43 Nucleocapsid CGATGAGGCTATTCCGACTAGGT CCTTCCTGAGCCTTCAATATAGTAACC CY5-TCCGCCTGGCACGGTACTCCCT- BHQ
  Human coronavirus NL63 1a gene ACGTACTTCTATTATGAAGCATGATATTAA AGCAGATCTAATGTTATACTTAAAACTACG VIC-ATTGCCAAGGCTCCTAAACGTACAGGTGTT-TAMRA
5 Respiratory syncitial virus A NP AGATCAACTTCTGTCATCCAGCAA TTCTGCACATCATAATTAGGAG FAM-CACCATCCAACGGAGCACAGGAGAT-BHQ
  Respiratory syncitial virus B NP AAGATGCAAATCATAAATTCACAGGA TGATATCCAGCATCTTTAAGTA FAM-TTTCCCTTCCTAACCTGGACATA-BHQ
  Rhinovirus 5'-UTR TGGACAGGGTGTGAAGAGC CAAAGTAGTCGGTCCCATCC VIC-TCCTCCGGCCCCTGAATG-TAMRA
  Adenovirus Matrix GCCACGGTGGGGTTTCTAAACTT GCCCCAGTGGTCTTACATGCACATC CY5-TGCACCAGACCCGGGCTCAGGTACTCCGA-BHQ