You are viewing the site in preview mode

Skip to main content

Advertisement

Table 1 Specific T. denticol a primers sets and cycling condition used in this study.

From: The central region of the msp gene of Treponema denticola has sequence heterogeneity among clinical samples, obtained from patients with periodontitis

Primer Nucleotide Sequence Amplicon Size Cycling conditions
Dent 1 Dent 2 5'TAATACCGAATGTGCTCATTTACAT3' 5'TCAAAGAAGCATTCCCTCTTCTTCTTA3' 316 bp 36 cycles 95°C 30" 60°C 1' 72°C 1'
Kx14 Kx04 5'GCTTGACAAGTGGATTTGGCTGTG3' 5'GAGAATAGCAGCAGAGTCTATTAG3' 1777 bp 30 cycles 94°C 1' 55°C 1' 72°C 3'
Kx14 Kx09 5'GCTTGACAAGTGGATTTGGCTGTG3' 5'CGAACGTCACCTTCGGTCTTTGAG3' 294 bp 31 cycles 94°C 1' 55°C 1' 72°C 1'
Td03 Td06 5'CTCAAAGACCGAAGGTGACGTTCG3' 5'GCATATTTGTTTGCTGCG3' 571 bp 31 cycles 94°C 1' 55°C 1' 72°C 1'
Td05 Kx04 5'CCGCAGCAAACAAATATGC3' 5' GAGAATAGCAGCAGAGTCTATTAG3' 875 bp 31 cycles 94°C 1' 55°C 1' 72°C 2'